Tuesday, April 23, 2024
HomeFactsHow To Kill Chlamydia Naturally

How To Kill Chlamydia Naturally

Yoghurt To Treat Chlamydia

Chlamydia treatment in 100 seconds

Yoghurt is loaded with antibiotic compounds and enzymes that pose this as one of the most effective remedies for the treatment of Chlamydia effect. The antibiotic properties are what helps fight off the excess growth of bacteria in the body which could be indicative of the presence and stellar growth of the infection relating to Chlamydia.

What to do?

While there are little to no side effects of these medications, some of these include possibilities of diarrhea and nausea but even that is not something predominant.

The only downside to contracting this disease during pregnancy is that there are possibilities of the baby contracting the infection during childbirth if you still couldnt get rid of Chlamydia for good before the delivery of the baby.

Can You Test Yourself For Stds At Home

Yes, in fact. Available evidence suggests that home testing kits are accurate and reliable. Moreover, theyre well-accepted and often the preferred method of testing for sexually transmitted infections.

Studies have shown greater testing rates for home-based testing versus the traditional office or clinic approach, suggesting better overall STI screening rates, especially among younger people, in the home approach.

Having said that, when you choose home testing, theres always the chance that youll perform the test incorrectly adding to the chance of a false negative result. Getting tested in a providers office allows for support, counseling and treatment potentially all in one visit.

What Are Common Side Effects Of Chlamydia Medication

Since antibiotics are the exclusive treatment for chlamydia, side effects tend to be pretty similar for those that experience them. However, this is not a full list and you should discuss any possible side effects with your healthcare professional.

Some of the most common side effects of chlamydia medication include:

Also Check: How Do Doctors Test For Chlamydia In Males

Over One In Five Women In A New Orleans Sti Clinic Cohort Naturally Clear C Trachomatis Between Their Ct Screening And Ct Treatment

Research samples from 55 women returning to the clinic for Ct treatment for a recently diagnosed Ct infection were analyzed. Twenty-seven were assessed for BV-Amsel at their Ct screening visit 20 were positive , 19 were prescribed metronidazole or metronidazole gel treatment per CDC guidelines and 18 were adherent 7 were BV-Amsel negative. The remaining 28 women were either not assessed or assessed by partial Amsel criteria for BV-Amsel at the Ct screening visit in the latter group 9/28 were symptomatic for BV and therefore metronidazole treated for presumptive BV and 7 were adherent . The cohort was predominantly young and African American with half documenting a previous Ct infection .

Figure 1 Study design. At the Ct screening visit, BV-positive was defined as an Amsel score of 3 of 4 by clinical assessment. All patients who were BV-Amsel positive after a full BV screen , or who were symptomatic for BV but with partial Amsel assessment , were prescribed metronidazole. All were compliant. For the Ct-treatment visit, when participants were enrolled, BV-positive was defined as a Nugent score of 7-10 by Gram stain. Abbreviations: MTZ, metronidazole AZI, azithromycin.

Common Home Remedies For Std Chlamydia

Chlamydia Symptoms, Pictures, Treatment

1. Oregano

Commercial-grade oregano oil has natural infection-fighting properties thanks to its carvacrol and thymol compounds. Pregnant or breastfeeding women should not take oregano oil. For others, daily intake shouldnt exceed 45 mg. Commercial-grade oregano oil is powerful and may cause side effects such as nausea, indigestion, upset stomach, or even vomiting. To start an oregano oil regimen, take it with coconut oil or water.

2. Garlic

Garlic is another of the most common home remedies for chlamydia and other ailments. Raw garlic has been a traditional home remedy for thousands of years, as its active compound allicin can help fight inflammatory disease and have antibacterial properties.

Potential side effects include heartburn, gas, bad breath, or diarrhea. Crush or chop the garlic and let it sit for ten minutes to form the allicin before you take it.

3. Echinacea

Echinacea is another traditional home remedy for many ailments.Research has shown that echinacea can boost the immune system and combat certain viral and bacterial infections.

Proponents recommend taking about 10 mg per two pounds of body weight for about a week and a half, or you can buy a supplement with pre-measured capsules. Potential side effects include dizziness, upset stomach, and nausea. Severe side effects include swelling and difficulty breathing.

4. Goldenseal

5. Turmeric

6. Olive Tree Extract

7. Probiotic Diet

8. Vitamins

9. Tea Tree Oil

10.Apple Cider Vinegar

11.Lemon

Read Also: How Effective Is Chlamydia Treatment

Address Chlamydia Naturally At Lifeworks

If you are looking for a more natural approach to treating chlamydia or other sexually transmitted diseases, consider coming to LifeWorks Wellness Center. We offer alternative and complementary approaches to getting well and try to avoid the unnecessary use of antibiotics where possible.

We look forward to working with you to develop a plan specifically designed to meet your needs and get you on a path to better health, naturally and holistically.

To discuss your health issue or to schedule an appointment, call us at our Clearwater clinic at or submit an online patient inquiry.

References

Do Natural Cures Work

Sexually transmitted diseases are generally caused by either a bacterial infection or a virus. Antibiotics are used to treat infections such as chlamydia, gonorrhoea and syphilis.

Unfortunately, if your STD is caused by a virus such as Herpes and HIV you will only be able to control the symptoms but never eliminate them altogether. Natural cures, therefore, dont cure sexually transmitted diseases, they only soothe the infection.

Also Check: How Do Females Know They Have Chlamydia

How Do I Know If I Have Chlamydia

Chlamydia often has no symptoms, but it can cause serious health problems, even without symptoms. If symptoms occur, they may not appear until several weeks after having sex with a partner who has chlamydia.

Even when chlamydia has no symptoms, it can damage a womans reproductive system. Women with symptoms may notice

  • An abnormal vaginal discharge and
  • A burning sensation when peeing.

Symptoms in men can include

  • A burning sensation when peeing and
  • Pain and swelling in one or both testicles .

See a healthcare provider if you notice any of these symptoms. You should also see a provider if your partner has an STD or symptoms of one. Symptoms can include

  • An unusual sore

How Chlamydias Passed On

How is Chlamydia treated? – Dr. Sudheendra Udbalker

Chlamydia is usually passed from one person to another through sexual contact.

Chlamydia is most commonly spread through:

  • sharing sex toys that arent washed or covered with a new condom each time theyre used.

It can be spread by giving or receiving oral sex with someone who has chlamydia. The risk can be lowered by using a condom or a dam to cover the genitals.

If youre pregnant its possible to pass chlamydia to the baby .

You cant get chlamydia from kissing, hugging, sharing baths or towels, swimming pools, toilet seats or from sharing cups, plates or cutlery.

Also Check: How Do Men Get Checked For Chlamydia

Chlamydia Symptoms + 5 Natural Treatments

By Kathleen McCoy, BS

Its the most common sexually transmitted disease that can be cured. Chlamydia infects both men and women across the globe. And the challenge with treatment, and keeping it from spreading, is that most people do not experience chlamydia symptoms. But, not having symptoms doesnt mean you shouldnt be concerned.

In fact, chlamydia can cause serious and permanent damage to the reproductive system. It may even make it extremely tough, or even impossible, to get pregnant. Sadly, it can also cause an ectopic pregnancy, which is a life-threatening condition.

Also, when a woman has chlamydia while pregnant, it is possible to infect the baby during childbirth. This can result in premature birth, a severe eye infection, or even pneumonia. Because of these and other dangers, it is important that sexually active people get tested regularly. Its critical that you always continue chlamydia treatments until the infection goes away.

How To Get Rid Of Chlamydia

The best way to treat this sexually transmitted infection is with the help of your healthcare professional. Your doctor will prescribe antibiotics to cure the infection quickly. Usually, the recommended treatment method for this sexually transmitted infection is one dose of azithromycin taken orally. Alternatively, doctors may suggest 100mg of doxycycline taken orally twice a day for one week.

With that in mind, some patients may want to skip these treatments and choose the natural route. According to some researchers, there are a few home remedies for chlamydia that have the potential of healing the infection. However, there is no hard evidence that a natural cure for chlamydia exists. While the following recommendations may help alleviate some of your symptoms linked to this sexually transmitted infection, they will not cure it entirely.

Don’t Miss: What Antibiotics Are Used For Chlamydia And Gonorrhea

Acupressure: How To Cure Chlamydia Naturally

Acupressure for Chlamydia treatment is an important part of the process of natural treatment of the disease. The points related to chlamydia treatment are mostly located in the pelvic and back area. Provided below is a list of the most important acupressure points and the recommended massage time for each of them.

  • Sacral Points located at the base of the spine, just above the tailbone. Apply steady and firm pressure on this point. Pressure on this point relieves sexual-reproductive problems.
  • Sea of Vitality these points are located on both sides of the spine, two inches away from the spine at waist level. Apply pressure on these points in order to alleviate lower-back aches and fatigue.
  • Bubbling Springs this acupressure point is located in the center of the sole of the foot. Applying light pressure on the point relieves hot flashes as well as impotency.
  • Three Mile Point This point is located on the muscle on the outer side of your leg, three inches below the kneecap. Massaging this point brings the positive effect of strengthening the whole body and the muscles, and improving sexual and reproductive conditions. Acupressure Points To Cure Chlamydia

Regularly massaging these acupressure points will greatly improve the symptoms of the Chlamydia infection, and this is an amazing natural treatment for the general well-being of your immune system.

Vaginal And Cervical Microbiomes

8 Chlamydia Herbal Remedies, Natural Treatments And Cure

DNA amplification was performed to prepare the sequencing library using the AccuPrime Taq high-fidelity DNA polymerase system as previously described . The 16S rDNA hypervariable region V4 was amplified using 20 ng of genomic DNA and gene-specific primers with the following Illumina adaptors: 5-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA-3 and 5-GTCTCGT GGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3 . Purified amplicon DNA from the last step with 25 cycles of PCR was then amplified for 8 cycles using the following primers with different molecular indexes: 5-AATGATACG GCGA CCACCGAGATCTACAC TCGTCGGCAGCGTC- 3 and 5- CAAGCAGAAGACGGCATACGAGAT GTCTCGTGGGCTCGG-3 . Normalized and pooled libraries were then run using 2×250 bp paired-end sequencing on an Illumina MiSeq with a 500 cycle V2 full sequencing kit.

Don’t Miss: What Medication Treats Chlamydia And Gonorrhea

Is Relying On Home Remedies To Treat Chlamydia A Good Idea

Relying on home remedies to cure chlamydia is not a good idea. Doing so increases your risk of health complications and passing the infection on to your sex partners. The only way to cure chlamydia is with antibiotics. However, if youre suffering from the symptoms of chlamydia, natural remedies may provide relief until you can get an STD test and see a doctor.

You can also use the home remedies for chlamydia to supplement your antibiotic treatment. For example, you could soak in a tea tree oil bath every night or take an echinacea supplement each morning. Pay close attention to correct dosages to prevent unwanted side effects.

Again, we want to emphasize this: You should never rely on home remedies alone to cure chlamydia. They wont work, and the infection can significantly damage your reproductive system if you dont treat it.

Remember, chlamydia is often asymptomatic. If you have unprotected sex with one or more sex partners, you should get regular STD tests. At Rapid STD Testing, we offer a full10-panel STD test you can order right now on our website. Then, visit one of our convenient locations to give a quick specimen, and youll have confidential results in one to three days.

Drug Resistance And Biopharmaceuticals

Natural biological materials and phytochemicals offer a wide range of compounds, such as flavonoids, coumarins, tannins, terpenoids, alkaloids, lipids, and peptides, many of which have been shown in vitro to exhibit antimicrobial as well as specific antichlamydial activity, and may prove to be sources of novel antichlamydial substances . However, even as researchers move forward with the identification and isolation of novel single compounds from natural materials, acquired drug resistance may still develop. To progress, it is likely that even with new natural compounds it will be necessary to employ an MDT approach. It is also important to consider that traditional formulations are natural examples of MDT, and the modern concept of MDT may help to explain how some traditional herbal formulations may be successful in treating various bacterial infections. Drug synergies may occur through the use of several compounds which exhibit inhibitory effects through various mechanisms of actions , and this may also lead to a reduction in the rate of acquired drug resistance. However, it seems that the microbial battle which has been playing out in nature throughout the evolutionary process will continue, and it is unclear whether it will ever be possible to identify a permanent single compound solution to the treatment of specific bacterial infections.

You May Like: How Long Until Chlamydia Shows Up On A Test

Cell Targeting And Entry

To enter their hosts, many viruses and bacteria bind to cell matrix- or cell cell-anchoring proteins, such as heparansulfate proteoglycans and integrins. Anionic HSPGs are involved in cell entry of species with sizes ranging from chlamydia trachomatis to adeno-associated virus . Interestingly, condensed DNA particles also require a cationic surface for gene delivery to occur , and their cell entry was shown to be mediated by electrostatic interaction with HSPGs

Ophthalmia Neonatorum Caused By C Trachomatis

3 Easy Ways to Prevent Gum Disease at Home!

A chlamydial etiology should be considered for all infants aged 30 days who experience conjunctivitis, especially if the mother has a history of chlamydial infection. These infants should receive evaluation and age-appropriate care and treatment.

Preventing Ophthalmia Neonatorum Caused by C. trachomatis

Neonatal ocular prophylaxis with erythromycin, the only agent available in the United States for this purpose, is ineffective against chlamydial ophthalmia neonatorum . As an alternative, prevention efforts should focus on prenatal screening for C. trachomatis, including

Neonates born to mothers for whom prenatal chlamydia screening has been confirmed and the results are negative are not at high risk for infection.

Diagnostic Considerations

Treatment

Erythromycin base or ethylsuccinate 50 mg/kg body weight/day orally, divided into 4 doses daily for 14 days*

* An association between oral erythromycin and azithromycin and infantile hypertrophic pyloric stenosis has been reported among infants aged < 6 weeks. Infants treated with either of these antimicrobials should be followed for IHPS signs and symptoms.

Although data regarding use of azithromycin for treating neonatal chlamydial infection are limited, available data demonstrate that a short therapy course might be effective . Topical antibiotic therapy alone is inadequate for treating ophthalmia neonatorum caused by chlamydia and is unnecessary when systemic treatment is administered.

Follow-Up

You May Like: How Can You Tell If A Woman Has Chlamydia

Chlamydia Is A Serious Infection

Chlamydia is Americas most common bacterial sexually transmitted infection. Every year, an estimated 2.86 million infections occur. Since its so common, you may assume that its no big deal. However, chlamydia can be a very serious infection.

Chlamydia is very common, but that doesnt mean it cant have a serious impact on your health. The infection can cause a number of long-term complications. In up to 15 percent of women with untreated chlamydia, the infection spreads to the uterus and uterine tubes, leading to symptomatic pelvic inflammatory disease. In addition, some women experience subclinical inflammation of the upper genital tract. This can cause permanent damage to the affected tissues.

Do Sti Home Remedies Work

Natural medicine can be an effective treatment for some sexually transmitted infections and can help to reduce the symptoms experienced by the individual. In some cases, natural remedies can provide safe and effective treatment. In others, medical treatments, such as antibiotics, may be necessary, although we would always recommend using complementary medicine alongside any conventional treatment to ensure the best results.

Nutrients such as vitamins A, C, E, zinc, and probiotics are important for proper immune functioning.

Vitamin A is necessary for the normal growth and integrity of epithelial tissues, such as the vaginal mucosa. Vitamin A also provides resistance to infection. A deficiency of vitamin A can increase susceptibility to genital tract infections, including syphilis2.

Vitamin C improves connective tissue integrity and can help reduce the spread of infection. It is useful in diminishing the frequency and severity of outbreaks of herpes.

Vitamin E increases the immune response and is useful in treating infections. It can be taken orally or applied topically to inflamed areas.

Low levels of zinc are associated with lowered immunity. Zinc is also essential for the proper utilisation of vitamin A. Treatment with topical and oral zinc can help reduce symptoms of herpes. High levels of zinc can also benefit symptoms of chlamydia and trichomoniasis that havent responded to antibiotic therapy.

Also Check: What Happens If You Have Chlamydia

How Is Chlamydia Treated

Chlamydia is treated with antibiotics. The same antibiotics a doctor prescribes to treat chlamydia in the groin may also be prescribed to treat chlamydia in the throat.

Avoid oral sex or intercourse for at least 7 days if youre taking a one-time antibiotic dose. If you take a longer course, you should wait until youve taken all your medication before having sex again.

If youve been treated for chlamydia before, you can get it again. Treatments also can stop complications you may have already experienced due to chlamydia.

After treatment, its a good idea to always have protected sex to avoid contracting a new infection.

CDC , having chlamydia in the throat might increase the risk for getting HIV.

Having chlamydia in the throat can make you more vulnerable to other infections. Your body is so busy fighting off the chlamydia bacteria, it doesnt fend off other infections as effectively. This can cause problems such as mouth infections, tooth loss, gum disease, and dental pain.

Risks of untreated chlamydia infections

  • increased risks for ectopic pregnancy
  • increased risks for preterm delivery in pregnant women
  • inflammation of the upper genital tract
  • pelvic inflammatory disease, a condition that affects fertility pelvic pain
  • perihepatitis, an inflammation in the capsule that surrounds the liver
  • reactive arthritis, a form of inflammatory arthritis

RELATED ARTICLES

Most Popular